Journal: NPJ Regenerative Medicine
Article Title: Immunomodulation by the combination of statin and matrix-bound nanovesicle enhances optic nerve regeneration
doi: 10.1038/s41536-024-00374-y
Figure Lengend Snippet: a Images of expression of GFP in RGCs (RBPMS + ) of the retina infected with AAV2-GFP-shCtr or AAV2-GFP-sh Fnta viruses. b Validation of downregulated expression of Fnta mRNA by quantitative RT-PCR in the retina treated with AAV2-GFP-sh Fnta viruses compared to AAV2-GFP-shCtr viruses ( n = 3, two-tailed unpaired t-test). c , d Downregulated protein expression of FNTA in the GCL (RBPMS + ) by AAV2-GFP-sh Fnta viruses compared to AAV2-GFP-shCtr viruses ( c ) and quantitative analysis of fold-change of FNTA expression in the GCL ( d ). ( n = 3, two-tailed unpaired t-test). e , f Images of CTB-labeled regenerated axons in the retina treated with AAV2-GFP-sh Fnta or AAV2-GFP-shCtr viruses two weeks after ONC ( e ), and quantitative analysis of the number of regenerated axons at 400, 800 and 1200 μm from the lesion site in each condition two weeks after ONC ( f ). ( n = 5, two-way ANOVA with Bonferroni’s test). g Schema of axon regeneration analysis four weeks after ONC in the retina with intravitreal injections (IVT inj.) of the combination of MBV and fluvastatin with AAV2-GFP-sh Fnta viruses or AAV2-GFP-shCtr viruses post-injury. h Images of CTB + regenerated axons in the retina treated with the combination of fluvastatin and MBV with AAV2-GFP-sh Fnta or AAV2-GFP-shCtr viruses four weeks after ONC. Tips of regenerated axons were observed near the optic chiasm, but they did not reach the brain (arrows). i Quantitative analysis of the number of regenerated axons at 2000–4000 μm from the lesion site in each condition four weeks after ONC. ( n = 5, two-way ANOVA with Bonferroni’s test). j , k Images of RBPMS + RGCs in the intact and injured retina in each condition four weeks after ONC ( j ), and quantitative analysis of RGC survival (%) based on the average of RGC survival in all four regions of the peripheral retina in each condition ( k ). ( n = 5, two-tailed unpaired t-test). Lesion sites marked by asterisks ( e and h ). Data presented as mean ± SD. N.S. not significant; Scale bars represent 20 μm ( a and c ) and 100 μm ( e , j and h ).
Article Snippet: 2 μl of AAV2-CMV-GFP-shCTR virus (control sequences:AGTATATCTATGCTTCTATCCGCTCAGGTGTATATCCTTGGATAGTGGCGTAACAACG, 4 × 10^13 GC/ml, VIROVEK) or AAV2-CMV-GFP-sh Fnta virus (target sequences: CCGGGAACTACATCACTGCGATAATCTCGAGATTATCGCAGTGATGTAGTTCTTTTTTG, 4 × 10^13 GC/ml, VIROVEK) were intravitreally injected two weeks before ONC or four days after ONC.
Techniques: Expressing, Infection, Quantitative RT-PCR, Two Tailed Test, Labeling
Addgene inc is a verified supplier 
