Review



aav2/5-cmv-hi-cre-gfp  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Addgene inc aav2/5-cmv-hi-cre-gfp
    Aav2/5 Cmv Hi Cre Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/aav2+cmv+gfp/pmc11179071-347-1-5?v=Addgene+inc
    Average 90 stars, based on 1 article reviews
    aav2/5-cmv-hi-cre-gfp - by Bioz Stars, 2026-08
    90/100 stars

    Images



    Similar Products

    90
    Virovek Inc aav2-cmv-gfp (reference 449b545)
    Aav2 Cmv Gfp (Reference 449b545), supplied by Virovek Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/aav2+cmv+gfp/pm40273568-62-0-14?v=Virovek+Inc
    Average 90 stars, based on 1 article reviews
    aav2-cmv-gfp (reference 449b545) - by Bioz Stars, 2026-08
    90/100 stars
      Buy from Supplier

    90
    Virovek Inc aav2-cmv-gfp
    Aav2 Cmv Gfp, supplied by Virovek Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/aav2+cmv+gfp/pmc11609365-201-0-4?v=Virovek+Inc
    Average 90 stars, based on 1 article reviews
    aav2-cmv-gfp - by Bioz Stars, 2026-08
    90/100 stars
      Buy from Supplier

    90
    Virovek Inc aav2-cmv-gfp-sh fnta virus
    a Images of expression of GFP in RGCs (RBPMS + ) of the retina infected with <t>AAV2-GFP-shCtr</t> or AAV2-GFP-sh Fnta viruses. b Validation of downregulated expression of Fnta mRNA by quantitative RT-PCR in the retina treated with AAV2-GFP-sh Fnta viruses compared to AAV2-GFP-shCtr viruses ( n = 3, two-tailed unpaired t-test). c , d Downregulated protein expression of FNTA in the GCL (RBPMS + ) by AAV2-GFP-sh Fnta viruses compared to AAV2-GFP-shCtr viruses ( c ) and quantitative analysis of fold-change of FNTA expression in the GCL ( d ). ( n = 3, two-tailed unpaired t-test). e , f Images of CTB-labeled regenerated axons in the retina treated with AAV2-GFP-sh Fnta or AAV2-GFP-shCtr viruses two weeks after ONC ( e ), and quantitative analysis of the number of regenerated axons at 400, 800 and 1200 μm from the lesion site in each condition two weeks after ONC ( f ). ( n = 5, two-way ANOVA with Bonferroni’s test). g Schema of axon regeneration analysis four weeks after ONC in the retina with intravitreal injections (IVT inj.) of the combination of MBV and fluvastatin with AAV2-GFP-sh Fnta viruses or AAV2-GFP-shCtr viruses post-injury. h Images of CTB + regenerated axons in the retina treated with the combination of fluvastatin and MBV with AAV2-GFP-sh Fnta or AAV2-GFP-shCtr viruses four weeks after ONC. Tips of regenerated axons were observed near the optic chiasm, but they did not reach the brain (arrows). i Quantitative analysis of the number of regenerated axons at 2000–4000 μm from the lesion site in each condition four weeks after ONC. ( n = 5, two-way ANOVA with Bonferroni’s test). j , k Images of RBPMS + RGCs in the intact and injured retina in each condition four weeks after ONC ( j ), and quantitative analysis of RGC survival (%) based on the average of RGC survival in all four regions of the peripheral retina in each condition ( k ). ( n = 5, two-tailed unpaired t-test). Lesion sites marked by asterisks ( e and h ). Data presented as mean ± SD. N.S. not significant; Scale bars represent 20 μm ( a and c ) and 100 μm ( e , j and h ).
    Aav2 Cmv Gfp Sh Fnta Virus, supplied by Virovek Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/aav2+cmv+gfp/pmc11513974-306-13-11?v=Virovek+Inc
    Average 90 stars, based on 1 article reviews
    aav2-cmv-gfp-sh fnta virus - by Bioz Stars, 2026-08
    90/100 stars
      Buy from Supplier

    90
    Virovek Inc aav2-cmv-gfp-shctr virus
    a Images of expression of GFP in RGCs (RBPMS + ) of the retina infected with <t>AAV2-GFP-shCtr</t> or AAV2-GFP-sh Fnta viruses. b Validation of downregulated expression of Fnta mRNA by quantitative RT-PCR in the retina treated with AAV2-GFP-sh Fnta viruses compared to AAV2-GFP-shCtr viruses ( n = 3, two-tailed unpaired t-test). c , d Downregulated protein expression of FNTA in the GCL (RBPMS + ) by AAV2-GFP-sh Fnta viruses compared to AAV2-GFP-shCtr viruses ( c ) and quantitative analysis of fold-change of FNTA expression in the GCL ( d ). ( n = 3, two-tailed unpaired t-test). e , f Images of CTB-labeled regenerated axons in the retina treated with AAV2-GFP-sh Fnta or AAV2-GFP-shCtr viruses two weeks after ONC ( e ), and quantitative analysis of the number of regenerated axons at 400, 800 and 1200 μm from the lesion site in each condition two weeks after ONC ( f ). ( n = 5, two-way ANOVA with Bonferroni’s test). g Schema of axon regeneration analysis four weeks after ONC in the retina with intravitreal injections (IVT inj.) of the combination of MBV and fluvastatin with AAV2-GFP-sh Fnta viruses or AAV2-GFP-shCtr viruses post-injury. h Images of CTB + regenerated axons in the retina treated with the combination of fluvastatin and MBV with AAV2-GFP-sh Fnta or AAV2-GFP-shCtr viruses four weeks after ONC. Tips of regenerated axons were observed near the optic chiasm, but they did not reach the brain (arrows). i Quantitative analysis of the number of regenerated axons at 2000–4000 μm from the lesion site in each condition four weeks after ONC. ( n = 5, two-way ANOVA with Bonferroni’s test). j , k Images of RBPMS + RGCs in the intact and injured retina in each condition four weeks after ONC ( j ), and quantitative analysis of RGC survival (%) based on the average of RGC survival in all four regions of the peripheral retina in each condition ( k ). ( n = 5, two-tailed unpaired t-test). Lesion sites marked by asterisks ( e and h ). Data presented as mean ± SD. N.S. not significant; Scale bars represent 20 μm ( a and c ) and 100 μm ( e , j and h ).
    Aav2 Cmv Gfp Shctr Virus, supplied by Virovek Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/aav2+cmv+gfp/pmc11513974-306-3-11?v=Virovek+Inc
    Average 90 stars, based on 1 article reviews
    aav2-cmv-gfp-shctr virus - by Bioz Stars, 2026-08
    90/100 stars
      Buy from Supplier

    90
    Virovek Inc aav2-cmv-gfp-shfnta virus
    a Images of expression of GFP in RGCs (RBPMS + ) of the retina infected with <t>AAV2-GFP-shCtr</t> or AAV2-GFP-sh Fnta viruses. b Validation of downregulated expression of Fnta mRNA by quantitative RT-PCR in the retina treated with AAV2-GFP-sh Fnta viruses compared to AAV2-GFP-shCtr viruses ( n = 3, two-tailed unpaired t-test). c , d Downregulated protein expression of FNTA in the GCL (RBPMS + ) by AAV2-GFP-sh Fnta viruses compared to AAV2-GFP-shCtr viruses ( c ) and quantitative analysis of fold-change of FNTA expression in the GCL ( d ). ( n = 3, two-tailed unpaired t-test). e , f Images of CTB-labeled regenerated axons in the retina treated with AAV2-GFP-sh Fnta or AAV2-GFP-shCtr viruses two weeks after ONC ( e ), and quantitative analysis of the number of regenerated axons at 400, 800 and 1200 μm from the lesion site in each condition two weeks after ONC ( f ). ( n = 5, two-way ANOVA with Bonferroni’s test). g Schema of axon regeneration analysis four weeks after ONC in the retina with intravitreal injections (IVT inj.) of the combination of MBV and fluvastatin with AAV2-GFP-sh Fnta viruses or AAV2-GFP-shCtr viruses post-injury. h Images of CTB + regenerated axons in the retina treated with the combination of fluvastatin and MBV with AAV2-GFP-sh Fnta or AAV2-GFP-shCtr viruses four weeks after ONC. Tips of regenerated axons were observed near the optic chiasm, but they did not reach the brain (arrows). i Quantitative analysis of the number of regenerated axons at 2000–4000 μm from the lesion site in each condition four weeks after ONC. ( n = 5, two-way ANOVA with Bonferroni’s test). j , k Images of RBPMS + RGCs in the intact and injured retina in each condition four weeks after ONC ( j ), and quantitative analysis of RGC survival (%) based on the average of RGC survival in all four regions of the peripheral retina in each condition ( k ). ( n = 5, two-tailed unpaired t-test). Lesion sites marked by asterisks ( e and h ). Data presented as mean ± SD. N.S. not significant; Scale bars represent 20 μm ( a and c ) and 100 μm ( e , j and h ).
    Aav2 Cmv Gfp Shfnta Virus, supplied by Virovek Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/aav2+cmv+gfp/pm39461953-299-13-23?v=Virovek+Inc
    Average 90 stars, based on 1 article reviews
    aav2-cmv-gfp-shfnta virus - by Bioz Stars, 2026-08
    90/100 stars
      Buy from Supplier

    90
    Addgene inc aav2/5-cmv-hi-cre-gfp
    a Images of expression of GFP in RGCs (RBPMS + ) of the retina infected with <t>AAV2-GFP-shCtr</t> or AAV2-GFP-sh Fnta viruses. b Validation of downregulated expression of Fnta mRNA by quantitative RT-PCR in the retina treated with AAV2-GFP-sh Fnta viruses compared to AAV2-GFP-shCtr viruses ( n = 3, two-tailed unpaired t-test). c , d Downregulated protein expression of FNTA in the GCL (RBPMS + ) by AAV2-GFP-sh Fnta viruses compared to AAV2-GFP-shCtr viruses ( c ) and quantitative analysis of fold-change of FNTA expression in the GCL ( d ). ( n = 3, two-tailed unpaired t-test). e , f Images of CTB-labeled regenerated axons in the retina treated with AAV2-GFP-sh Fnta or AAV2-GFP-shCtr viruses two weeks after ONC ( e ), and quantitative analysis of the number of regenerated axons at 400, 800 and 1200 μm from the lesion site in each condition two weeks after ONC ( f ). ( n = 5, two-way ANOVA with Bonferroni’s test). g Schema of axon regeneration analysis four weeks after ONC in the retina with intravitreal injections (IVT inj.) of the combination of MBV and fluvastatin with AAV2-GFP-sh Fnta viruses or AAV2-GFP-shCtr viruses post-injury. h Images of CTB + regenerated axons in the retina treated with the combination of fluvastatin and MBV with AAV2-GFP-sh Fnta or AAV2-GFP-shCtr viruses four weeks after ONC. Tips of regenerated axons were observed near the optic chiasm, but they did not reach the brain (arrows). i Quantitative analysis of the number of regenerated axons at 2000–4000 μm from the lesion site in each condition four weeks after ONC. ( n = 5, two-way ANOVA with Bonferroni’s test). j , k Images of RBPMS + RGCs in the intact and injured retina in each condition four weeks after ONC ( j ), and quantitative analysis of RGC survival (%) based on the average of RGC survival in all four regions of the peripheral retina in each condition ( k ). ( n = 5, two-tailed unpaired t-test). Lesion sites marked by asterisks ( e and h ). Data presented as mean ± SD. N.S. not significant; Scale bars represent 20 μm ( a and c ) and 100 μm ( e , j and h ).
    Aav2/5 Cmv Hi Cre Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/aav2+cmv+gfp/pmc11179071-347-1-5?v=Addgene+inc
    Average 90 stars, based on 1 article reviews
    aav2/5-cmv-hi-cre-gfp - by Bioz Stars, 2026-08
    90/100 stars
      Buy from Supplier

    96
    Addgene inc aav2 gfp
    a Images of expression of GFP in RGCs (RBPMS + ) of the retina infected with <t>AAV2-GFP-shCtr</t> or AAV2-GFP-sh Fnta viruses. b Validation of downregulated expression of Fnta mRNA by quantitative RT-PCR in the retina treated with AAV2-GFP-sh Fnta viruses compared to AAV2-GFP-shCtr viruses ( n = 3, two-tailed unpaired t-test). c , d Downregulated protein expression of FNTA in the GCL (RBPMS + ) by AAV2-GFP-sh Fnta viruses compared to AAV2-GFP-shCtr viruses ( c ) and quantitative analysis of fold-change of FNTA expression in the GCL ( d ). ( n = 3, two-tailed unpaired t-test). e , f Images of CTB-labeled regenerated axons in the retina treated with AAV2-GFP-sh Fnta or AAV2-GFP-shCtr viruses two weeks after ONC ( e ), and quantitative analysis of the number of regenerated axons at 400, 800 and 1200 μm from the lesion site in each condition two weeks after ONC ( f ). ( n = 5, two-way ANOVA with Bonferroni’s test). g Schema of axon regeneration analysis four weeks after ONC in the retina with intravitreal injections (IVT inj.) of the combination of MBV and fluvastatin with AAV2-GFP-sh Fnta viruses or AAV2-GFP-shCtr viruses post-injury. h Images of CTB + regenerated axons in the retina treated with the combination of fluvastatin and MBV with AAV2-GFP-sh Fnta or AAV2-GFP-shCtr viruses four weeks after ONC. Tips of regenerated axons were observed near the optic chiasm, but they did not reach the brain (arrows). i Quantitative analysis of the number of regenerated axons at 2000–4000 μm from the lesion site in each condition four weeks after ONC. ( n = 5, two-way ANOVA with Bonferroni’s test). j , k Images of RBPMS + RGCs in the intact and injured retina in each condition four weeks after ONC ( j ), and quantitative analysis of RGC survival (%) based on the average of RGC survival in all four regions of the peripheral retina in each condition ( k ). ( n = 5, two-tailed unpaired t-test). Lesion sites marked by asterisks ( e and h ). Data presented as mean ± SD. N.S. not significant; Scale bars represent 20 μm ( a and c ) and 100 μm ( e , j and h ).
    Aav2 Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/aav2+cmv+gfp/pm38086421-378-13-14?v=Addgene+inc
    Average 96 stars, based on 1 article reviews
    aav2 gfp - by Bioz Stars, 2026-08
    96/100 stars
      Buy from Supplier

    Image Search Results


    a Images of expression of GFP in RGCs (RBPMS + ) of the retina infected with AAV2-GFP-shCtr or AAV2-GFP-sh Fnta viruses. b Validation of downregulated expression of Fnta mRNA by quantitative RT-PCR in the retina treated with AAV2-GFP-sh Fnta viruses compared to AAV2-GFP-shCtr viruses ( n = 3, two-tailed unpaired t-test). c , d Downregulated protein expression of FNTA in the GCL (RBPMS + ) by AAV2-GFP-sh Fnta viruses compared to AAV2-GFP-shCtr viruses ( c ) and quantitative analysis of fold-change of FNTA expression in the GCL ( d ). ( n = 3, two-tailed unpaired t-test). e , f Images of CTB-labeled regenerated axons in the retina treated with AAV2-GFP-sh Fnta or AAV2-GFP-shCtr viruses two weeks after ONC ( e ), and quantitative analysis of the number of regenerated axons at 400, 800 and 1200 μm from the lesion site in each condition two weeks after ONC ( f ). ( n = 5, two-way ANOVA with Bonferroni’s test). g Schema of axon regeneration analysis four weeks after ONC in the retina with intravitreal injections (IVT inj.) of the combination of MBV and fluvastatin with AAV2-GFP-sh Fnta viruses or AAV2-GFP-shCtr viruses post-injury. h Images of CTB + regenerated axons in the retina treated with the combination of fluvastatin and MBV with AAV2-GFP-sh Fnta or AAV2-GFP-shCtr viruses four weeks after ONC. Tips of regenerated axons were observed near the optic chiasm, but they did not reach the brain (arrows). i Quantitative analysis of the number of regenerated axons at 2000–4000 μm from the lesion site in each condition four weeks after ONC. ( n = 5, two-way ANOVA with Bonferroni’s test). j , k Images of RBPMS + RGCs in the intact and injured retina in each condition four weeks after ONC ( j ), and quantitative analysis of RGC survival (%) based on the average of RGC survival in all four regions of the peripheral retina in each condition ( k ). ( n = 5, two-tailed unpaired t-test). Lesion sites marked by asterisks ( e and h ). Data presented as mean ± SD. N.S. not significant; Scale bars represent 20 μm ( a and c ) and 100 μm ( e , j and h ).

    Journal: NPJ Regenerative Medicine

    Article Title: Immunomodulation by the combination of statin and matrix-bound nanovesicle enhances optic nerve regeneration

    doi: 10.1038/s41536-024-00374-y

    Figure Lengend Snippet: a Images of expression of GFP in RGCs (RBPMS + ) of the retina infected with AAV2-GFP-shCtr or AAV2-GFP-sh Fnta viruses. b Validation of downregulated expression of Fnta mRNA by quantitative RT-PCR in the retina treated with AAV2-GFP-sh Fnta viruses compared to AAV2-GFP-shCtr viruses ( n = 3, two-tailed unpaired t-test). c , d Downregulated protein expression of FNTA in the GCL (RBPMS + ) by AAV2-GFP-sh Fnta viruses compared to AAV2-GFP-shCtr viruses ( c ) and quantitative analysis of fold-change of FNTA expression in the GCL ( d ). ( n = 3, two-tailed unpaired t-test). e , f Images of CTB-labeled regenerated axons in the retina treated with AAV2-GFP-sh Fnta or AAV2-GFP-shCtr viruses two weeks after ONC ( e ), and quantitative analysis of the number of regenerated axons at 400, 800 and 1200 μm from the lesion site in each condition two weeks after ONC ( f ). ( n = 5, two-way ANOVA with Bonferroni’s test). g Schema of axon regeneration analysis four weeks after ONC in the retina with intravitreal injections (IVT inj.) of the combination of MBV and fluvastatin with AAV2-GFP-sh Fnta viruses or AAV2-GFP-shCtr viruses post-injury. h Images of CTB + regenerated axons in the retina treated with the combination of fluvastatin and MBV with AAV2-GFP-sh Fnta or AAV2-GFP-shCtr viruses four weeks after ONC. Tips of regenerated axons were observed near the optic chiasm, but they did not reach the brain (arrows). i Quantitative analysis of the number of regenerated axons at 2000–4000 μm from the lesion site in each condition four weeks after ONC. ( n = 5, two-way ANOVA with Bonferroni’s test). j , k Images of RBPMS + RGCs in the intact and injured retina in each condition four weeks after ONC ( j ), and quantitative analysis of RGC survival (%) based on the average of RGC survival in all four regions of the peripheral retina in each condition ( k ). ( n = 5, two-tailed unpaired t-test). Lesion sites marked by asterisks ( e and h ). Data presented as mean ± SD. N.S. not significant; Scale bars represent 20 μm ( a and c ) and 100 μm ( e , j and h ).

    Article Snippet: 2 μl of AAV2-CMV-GFP-shCTR virus (control sequences:AGTATATCTATGCTTCTATCCGCTCAGGTGTATATCCTTGGATAGTGGCGTAACAACG, 4 × 10^13 GC/ml, VIROVEK) or AAV2-CMV-GFP-sh Fnta virus (target sequences: CCGGGAACTACATCACTGCGATAATCTCGAGATTATCGCAGTGATGTAGTTCTTTTTTG, 4 × 10^13 GC/ml, VIROVEK) were intravitreally injected two weeks before ONC or four days after ONC.

    Techniques: Expressing, Infection, Quantitative RT-PCR, Two Tailed Test, Labeling